Transcript: MROH8-007 OTTHUMT00000280539.1

Description

maestro heat-like repeat family member 8

Location

Chromosome 20: 37,128,821-37,179,571 reverse strand.

About this transcript

This transcript has 13 exons and is annotated with 6 domains and features.

Gene

This transcript is a product of gene OTTHUMG00000032407 Show transcript tableHide transcript table

Name	Transcript ID	bp	Protein	Translation ID	Biotype	CCDS	Flags
MROH8-003	OTTHUMT00000079071.2	3425	1069aa	OTTHUMP00000030896	<p>Genes and/or transcript that contains an open reading frame (ORF).</p>Protein coding	-	5' truncation in transcript evidence prevents annotation of the start of the CDS.CDS 5' incomplete
MROH8-006	OTTHUMT00000079074.1	2227	670aa	OTTHUMP00000030898	<p>Genes and/or transcript that contains an open reading frame (ORF).</p>Protein coding	-	5' truncation in transcript evidence prevents annotation of the start of the CDS.CDS 5' incomplete
MROH8-007	OTTHUMT00000280539.1	2088	629aa	OTTHUMP00000180603	<p>Genes and/or transcript that contains an open reading frame (ORF).</p>Protein coding	-	5' truncation in transcript evidence prevents annotation of the start of the CDS.CDS 5' incomplete
MROH8-001	OTTHUMT00000079069.2	2000	600aa	OTTHUMP00000030894	<p>Genes and/or transcript that contains an open reading frame (ORF).</p>Protein coding	-	5' truncation in transcript evidence prevents annotation of the start of the CDS.CDS 5' incomplete
MROH8-004	OTTHUMT00000079072.2	675	24aa	OTTHUMP00000030897	<p>Genes and/or transcript that contains an open reading frame (ORF).</p>Protein coding	-	3' truncation in transcript evidence prevents annotation of the end of the CDS.CDS 3' incomplete
MROH8-002	OTTHUMT00000079070.3	531	34aa	OTTHUMP00000030895	<p>Genes and/or transcript that contains an open reading frame (ORF).</p>Protein coding	-	3' truncation in transcript evidence prevents annotation of the end of the CDS.CDS 3' incomplete
MROH8-005	OTTHUMT00000079073.1	471	No protein	-	<p>Transcripts that don't contain an open reading frame (ORF) and cannot be placed in one of the other categories.</p>Processed transcript	-

Summary

Statistics

Exons: 13 Transcript length: 2,088 bps Translation length: 629 residues

Class

protein coding [Definition]

Author

This transcript was annotated by Havana

Version & date

Version 1, last modified on 28/02/2014 (Created on 10/10/2006)

Alternative symbols

RP4-621N11.1-007

Remarks

genomic sequence contains a polymorphism/deletion at bp 19644-19467. Supporting evidence EM:BC057767.1 contains 29 additional nucleotides AGTGCCGGCCGCGGGGCCCTGTCTATAAG which are missing from the alignment with genomic sequence at this point and allow the ORF to be extended 5' to an upstream methionine

CDS start not found

mRNA start not found

Other assemblies

This transcript maps to 37,128,821-37,179,571 in GRCh38 (Ensembl) coordinates.

Jump to this stable ID in Ensembl

Alternative transcripts

Ensembl transcript having exact match with Havana:	ENST00000400440

Curation Method

Manual annotation from Havana

Select a species

Recent locations

Transcript: MROH8-007 OTTHUMT00000280539.1

Summary

Transcript-based displays